Invivogen Thp1 Nlrc4

Lab Reagents

Human IgG antibody Laboratories manufactures the invivogen thp1 nlrc4 reagents distributed by Genprice. The Invivogen Thp1 Nlrc4 reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact InVivoGen. Other Invivogen products are available in stock. Specificity: Invivogen Category: Thp1 Group: Nlrc4

Nlrc4 information

NLRC4 Rabbit pAb

A13117-50ul 50 ul
EUR 223

NLRC4 (pSer533) Antibody

abx224243-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

NLRC4 (pS533) Antibody

abx224383-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

NLRC4 cloning plasmid

CSB-CL873615HU-10ug 10ug
EUR 1134
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3075
  • Sequence: atgaatttcataaaggacaatagccgagcccttattcaaagaatgggaatgactgttataaagcaaatcacagatgacctatttgtatggaatgttctgaatcgcgaagaagtaaacatcatttgctgcgagaaggtggagcaggatgctgctagagggatcattcacatgattt
  • Show more
Description: A cloning plasmid for the NLRC4 gene.

NLRC4 Rabbit pAb

A7382-100ul 100 ul
EUR 308

NLRC4 Rabbit pAb

A7382-200ul 200 ul
EUR 459

NLRC4 Rabbit pAb

A7382-20ul 20 ul
EUR 183

NLRC4 Rabbit pAb

A7382-50ul 50 ul
EUR 223

Anti-NLRC4 antibody

STJ115083 100 µl
EUR 277
Description: This gene encodes a member of the caspase recruitment domain-containing NLR family. Family members play essential roles in innate immune response to a wide range of pathogenic organisms, tissue damage and other cellular stresses. Mutations in this gene result in autoinflammation with infantile enterocolitis. Alternative splicing results in multiple transcript variants.

Anti-NLRC4 antibody

STJ29519 100 µl
EUR 277
Description: This gene encodes a member of the caspase recruitment domain-containing NLR family. Family members play essential roles in innate immune response to a wide range of pathogenic organisms, tissue damage and other cellular stresses. Mutations in this gene result in autoinflammation with infantile enterocolitis. Alternative splicing results in multiple transcript variants.

Recombinant Saccharomyces Cerevisiae THP1 Protein (aa 1-455) [His]

VAng-Wyb6018-1mg 1 mg
EUR 5015
Description: Saccharomyces Cerevisiae (strain ATCC 204508 / S288c) Thp1p protein, recombinant protein.

Human NLRC4 ELISA Kit

ELA-E1535h 96 Tests
EUR 824

NLRC4 ELISA KIT|Human

EF005930 96 Tests
EUR 689

Rat NLRC4 shRNA Plasmid

20-abx988957
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NLRC4 Polyclonal Conjugated Antibody

C27907 100ul
EUR 397

NLRC4 Polyclonal Conjugated Antibody

C30909 100ul
EUR 397

Mouse NLRC4 shRNA Plasmid

20-abx983002
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.